Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E414317

Search information 
Request: 414317Match: SGN-E414317
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269260Clone name: STM-19-G8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269260 [STM-19-G8] Trace: SGN-T266455 EST: SGN-E414318 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414317Length: 650 bp (966 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E414317 [] (trimmed) GGCACTGTATCTTCTTCAGGATGTTATCTCAAAGTTGGACCTCAAAATAAGACTTTGTATCAGAGATAGTTTGTTCCGACTGGCTCAAAGTGCTA
CACAGAGGCAATGTGGCAATGATAGTTGCGGCACTAAGAAGGGTGGAAGAGAAGTCAGCAAGGAAGAGATAAACACCGATAACAGACCACCCCAT
GTAGAGACCGAGACGAATCCAATAGACCGCACTGTAGCTCATCTGCTCTTCTACAATCCATCAGAGTTGCCGTCAAAACTTGCTGAATTTCCCAA
GTCATCAATGTTTTCAATGCTCAATTGTGAAAGAGAAGCAATTGGTTCACCAAGCTTCCCAAGCAGATTTTCACAACAGAATTCTGAAACTAATT
CAACCACAGCTCTCCAGGGACCAAAAGCTTCTACCTCATATAATGAAGTGGATATAATGAGAAGTAGCCCCTGCACTGAGACTTCTGAGAATGCA
TCAAACAATGAAGGAGCAGATGGTAGTGTTATTGGAGTTGAAGCCACATCGTGAAACAATCCTATCATCAGATATATTCAACTGGACATTGAGCA
ACCATGACTCCATGAGCTACAAGATTTGAAATTTTAGGAGTCTCTGTTGTACCCTGGAAAAAGAAACCTCTTTTATGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414317] SGN-U274933 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266454 [Download] [View] Facility Assigned ID: STMCV40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5