Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E414604

Search information 
Request: 414604Match: SGN-E414604
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269274Clone name: STM-19-H4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269274 [STM-19-H4] Trace: SGN-T266740 EST: SGN-E414603 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414604Length: 684 bp (966 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E414604 [] (trimmed) CAACCTTTTTTTTTTTTTTTTTTTTTTTTTGAACAACCAAAAATCGTCGGAGTTCATTACTTTATGAAGCAATAGATGATGCCCAATACAAAATT
AAACTTAAACAATGGGACTAGTAATTACCAAACATAATTATTTATCAAGCATCGCTAAATGAAAATTAAAGCAAATAGCATCCTAATAAACTCTA
TCTTTCTATTACCAAATACCAACATCCATAAATCCATCTTCAGTAGCACATCCTCTAAACATTCCATTACAATTAAACCCATAAGCCACTTCCCC
TTTATTAGACACAGCAATAAGCCCAGCAAACCCATTATCCAATCTCTTCTTAATCACAAAGTCCACTGCTTCTTGAAGGCCCAATTCCTTATATT
CCATAACCGCTGCCACGTCACGTGCTAGGGTTCCACGTATGATAGCTTCTCCTTCACCTGTACATGAGACCCCACAAAGCTCACCTGCGTAGGTC
CCAGCACCAATCAGCGGTGAGTCACCGATACGACCGGTCATTTTGTTCATTAAACCACCGGTGGATGTGGCGGCGGCGCACCTACCTTGGCCGTC
TACCACCACACATCCCACCGTCTCCGGNGCGTAAACACTTATCGGTAATCCGTTCATGCGAATAGGGCTTTCAACGGATGACGCACAGGAATCCA
ATCCAGTTAATGGAATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414604] SGN-U271698 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266741 [Download] [View] Facility Assigned ID: STMCX38TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5