EST details — SGN-E414613
| Search information |
| Request: 414613 | Match: SGN-E414613 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C269267 | Clone name: STM-19-H16 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C269267 [STM-19-H16] | Trace: SGN-T266751 | EST: SGN-E414614 | Direction: 3' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E414613 | Length: 191 bp (903 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E414613 [] (trimmed)
GGCTTTCTCCTCGCCGCTGTTTTCTCCGGTTAACTTCACCTTAAACCCTAATCCCCAACTCCATCATCCTAAATGCACAAAGCCAAACAACCGCC
GGAGCTTCTCCGTCTGCGCCATTCCGCCGCTCTCCACCGCCACCGACATCTNCGCCGTCACCGGTCCGTTGGACGGAACGACTATCGCCGTACTT
G
GGAGCTTCTCCGTCTGCGCCATTCCGCCGCTCTCCACCGCCACCGACATCTNCGCCGTCACCGGTCCGTTGGACGGAACGACTATCGCCGTACTT
G
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E414613] | SGN-U273876 | Solanum tuberosum | Build 4 | 8 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T266750 [Download] [View] | Facility Assigned ID: STMCX44TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.931 | Expected Error Rate: 0.0205 | Quality Trim Threshold: 14.5 |
Working
