EST details — SGN-E414623

Search information 
Request: 414623Match: SGN-E414623
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269321Clone name: STM-19-J4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269321 [STM-19-J4] Trace: SGN-T266761 EST: SGN-E414624 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414623Length: 634 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E414623 [] (trimmed) TTCTTCTCACCAAAGCAAAAGCTTTCACACTTTTTTCCCCTACATTTCATCACGTCTCAGACCAGTTGTTCTCAAGGTTGGTATGTCATGCCAAG
GCTGTGTTGGAGCTGTCAACAGAGTTTTGGGCAAAATGGAAGGTGTTGAATCATTTGACATCGATATAAAGGAGCAAAAAGTGACCGTAAAAGGA
AATGTGGAACCAGACGCTGTTTTCCAGACTGTTTCAAAGACTGGAAAGAAGAACTTCGTTTTGGGAAGCACCAGCACCAGCACCAGCACCAGCAC
CAACACCAGCTGAACCCGAAACAAAGCCCGTAGAAGAAAAGCCCACAGAAACACCAGCTGAGCCCGAACCAAAGCCCGCGGAAGAAAAGCCCGCA
GAAACTGTTGCTCCAGCATGATGATGATATAGCTTAATTAATGGGCTGAAAATTTATACCATATGCTTGTGATTTATACTAAAGCCAGAATGTGA
TCTTAATGAGTGCTGAAATAATTGTCTTGCTAATTTTCTGTGTTTGGTTTTCTTGTAATGTTGATAGTAAGTTTTGCTATCAAATCATGTATCTT
GTATTTTAATTTGTGCATGTTTTGGATCATCAAAAAGATTACCATTTGAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414623] SGN-U270018 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266760 [Download] [View] Facility Assigned ID: STMCX50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0107 Quality Trim Threshold: 12.5