EST details — SGN-E414636

Search information 
Request: 414636Match: SGN-E414636
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269312Clone name: STM-19-J18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269312 [STM-19-J18] Trace: SGN-T266772 EST: SGN-E414635 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414636Length: 775 bp (949 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E414636 [] (trimmed) CACCTTTTTTTAGGAATGACCGTCCAATGTATTCTCATTTTAGTTTGTTCAAAAAGGATCTATATACTGAGGTCTATAAGGTTCATAGTTACAAG
AGAAATAAAAAGGTTAGTTACTAAACAATTATCAATCTCTGCAAAATCCAGGCGTACATGACTTTTGATGACATTAATAAAGCCTTTCAATAATG
CTAATTACGCAATTCTTTTGCCTTTTTGTCCAAAATTACTTCTCCTTTTCTTTTCTTGCTTTCACCTACTAGCCTCTTAACGTATGAAATATATC
CCTCCACGTTAAACTTCCTCTTGCAACCTGCGTAGTTCATGTACCTGATTTTCCCAAATACCGGGCGCTCTCGCCAACCCTGGTCGTGTACGCCA
CATATTGACCACATGCATCCAACATAACCACTAGGATCTCTACCATCTATATGATACTTATCATTTAAATATATTGTGATAGCCAGAGCTTCTTC
TGGTCCATTTGTCCATTCGAGTATCTTTTTAGCCCAATACATCCTCATAAAACCATGCATTTTCCCATAATGAACCATCTCTAATTGAGAAGCAT
TCCACAGAGGGTCTGCAGTTTGCGCCTTCTCCAATTGCTCTCGCGTGTATATATGTTCTCGTTTATCAGATGCATGTTCCATTAAGGTTTTACGC
GCCCATTCCCATGCACCCAATAATGAATCATATTGAGGCTGGTAATACCAGAAGTTATCAAAAAGCTCTCTGCGCACAATCATTTCCTCCAGAAA
TGTGTCAACTGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414636] SGN-U294253 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266773 [Download] [View] Facility Assigned ID: STMCX57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5