Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E414699

Search information 
Request: 414699Match: SGN-E414699
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269471Clone name: STM-20-A3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414699Length: 492 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E414699 [] (trimmed) CTGTAATGGGGGTTCTTGGTTAAACCCTCAAATTCCTTAATTTTTTAGGATTTTTCTGTTCAAGCACTATTTTTTACCAATACCCTTTTGCTAAT
TTTGGATTCTTGAAAAGTTCTAGGAATTACTGTAACAAACTTATTGTTGTTAGGGTAGTGTAATTTTTGTGCATTTTCTTGAAATGGAACCGAAT
TCACCTGTGAGATTCAAATTAGGTAAGCAATCTTCATTAGCACCAGAGAGGAGGGGGGAAGAAGTATTAGGAGGTGAAGATGATGGATTTGTTAT
TGATATTGATCCAAGGGTTAGGTTGATGTATTCGGCAAATGAGGGTGATATAGAAGGGATAAAGGAGATTTTGGAATCAGGGACTGATGTTAATT
TTAGGGATATTGATGAGAGGACTGCACTTCATGTTGCTGCTTGTCATGGTTCAAGTGATGTCGTGCAGTTGTTGCTTGATAATGGGGCTGAAGTT
GATCCAAAAGATCGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414699] SGN-U284427 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T266836 [Download] [View] Facility Assigned ID: STMCY02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5