Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E414872

Search information 
Request: 414872Match: SGN-E414872
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269546Clone name: STM-20-E22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269546 [STM-20-E22] Trace: SGN-T267010 EST: SGN-E414873 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E414872Length: 618 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E414872 [] (trimmed) ATTAAAGCATATGGCAAGTTGTAACATGGCTTCTGCTGCATCAAGTTTTTTGGTGGCAACTCCTAATGTTGCCTCCAACACCACTTCTCGTACTA
ATATGTTGTTTTTTCCCTCCAACAAGATCACCACCACCCCGAGACTCGTCGTAAGGGCGGCCGCGGAAGAGGCTGCCGCACCAGCCGCGGCCGCT
GCTACCGCTGAACCAGCTGTTGAAACCAAAGCTGCTAAGCCACCTCCAATTGGACCCAAGAGGGGATCCAAGGTAATTCTCTTAGTCCTGTTAAT
AGTAATAGTCAAAGTTCGATAATATATTTGAGTCTTAGAATGACTTGATTGATAAAGCCTATGCCACCTTATTGGGAATTGAGGCGTATGTTATT
ATTGTATTACAAATGGAAAGAAATCATGAATATGTTATGAACTGTCCAGACAAATTATTATCCTATAGATGTTGTATCTACACATGTTCAAAATG
TTATCACGAAAGAGTAGTGAATATCATGATATTTTGCATCGATTGATTCATCTGAATCATGTTTGAGAATGTGTTTGATACGGAGAAAAATATTT
TTCACGGAGAACATCTAAATGAATATTATTTGACAGGTGAGAGTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E414872] SGN-U272328 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267009 [Download] [View] Facility Assigned ID: STMCZ35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5