EST details — SGN-E415281

Search information 
Request: 415281Match: SGN-E415281
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269905Clone name: STM-21-G1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269905 [STM-21-G1] Trace: SGN-T267419 EST: SGN-E415282 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415281Length: 333 bp (931 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E415281 [] (trimmed) TTGGGGTTGCTGTTGCAGCTGTTGCTGTTGGTGCTACAGCTTATTTTTACTTCTCTTCCAAGAAGTCCAAAGTATGTTTAAACCCTGAAGAATTC
AGGGCATTTAAGCTTGTGAAGCGCACACAACTTAGCCATAATGTGGCGAAATTCAGATTTGAACTTCCAATGCCCACTTCTGTGTTGGGACTACC
CATTGGACAACATATTAGTTGCAGGGGCAAAGATAGTCAAGGTGAAGAGGTTGTTAAACCATACACACCAACTACTTTGGACTCGGACATTGGAT
ATTTTGAGTTAGTTATAAAGATGTATCCCCAAGGAAGGATGTCACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415281] SGN-U272305 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267418 [Download] [View] Facility Assigned ID: STMDC37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0044 Quality Trim Threshold: 20.5