EST details — SGN-E415308

Search information 
Request: 415308Match: SGN-E415308
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269958Clone name: STM-21-I21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269958 [STM-21-I21] Trace: SGN-T267446 EST: SGN-E415309 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415308Length: 622 bp (927 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E415308 [] (trimmed) CCAAAACCTCAGGAATTTCACAGCCCATGTCTTATTTCATCACCAGATAGCCATAGCTCCAACAGTTCAAGCTGTAGCAATAGCAGCAATTCTAA
CCACCACCACCACCACCACAACAATGGTCTTCATCACCACCACCGCCGCCACCCAACACCACCCACTACCCCAACACCTACACCACCACCACCAC
TACCCATCACCAGATCCGAACCCAACAACCCGTACCCGACTACCTTCGTTCAAGCTGACGCTTCCTCTTTCAAACAGGTAGTTCAAATGCTTACT
GGGTCCTCTGAAACGGCCAAGGTTGGTGCTAATTCGGGCCGTACTGAGCCCGTTAGGAATCCGATCCCTCCAATTAAAACTGGAACTAAGAAGGA
GAAATCAAGTTCAAAGCTGTATGAGAGAAGGAACAGCATGAAGAATTTCAAAATTAGCCCATTGGGTCCTGGGGTTGTGAATAAATCCCTTTTCT
CTGCTGGGTTTTTGGGTTCTCCGAGAACTGCGACGCCAGAGATTTTGTCCCCGAGCATTCTCGATTTTCCGGCGCTGGCGCTTAGCCCGGTAACC
CCTCTCATACCCGACCCGTTTAACCGGTCGCCTCACAGTGCTGCAAGTACCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415308] SGN-U277675 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267445 [Download] [View] Facility Assigned ID: STMDC59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5