EST details — SGN-E415324

Search information 
Request: 415324Match: SGN-E415324
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269993Clone name: STM-21-K15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269993 [STM-21-K15] Trace: SGN-T267460 EST: SGN-E415323 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415324Length: 640 bp (932 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E415324 [] (trimmed) TTTTTTTTTTGAAGAATAAAGATCCATTAATCAACACTCAATTTCTTCCATAAACATCAGTACTTGGACAAGCTACTCATCAGTACGTCGTGGAC
CAAACTGTTCCACTTGCTTGATAAGTTAACTAGCTTTGCTCAGGATAATGAATATCAATGCCAATTAATTTAGCAGCTTTCAACTGATATATGGT
CCAGGCATTTGTACAATTAGAATAGAAGACGTCAAATCGATTGACTCCAGTTAGATAAAAATTTTGGCTGAAGAATGCCGTCATTACAGGGAAAG
CAAGGAGGGGGGTAATTTAAACCTGAGGTTGTGCCATATGCCTGCCAGCAAAAAAATGTTGCAGGATCCCCCGAAGATGAAGTAAGTTGAATATC
TTCCAAGTACAACTTTCTGCAGGGGAAGCTATCGCTGCAGGCAAGTGTTACTGCCCTTTCTGTAGCTGAAGTTCCTTTAATACCCATAAAGGATA
TGCTGTCAATGCGAATATTTGAAGTCTTGTTTGAACAGGGTTTCGTAGAATCACAATAATATTGGTCGATTATGATAGGATTTGAGACGTTTTCC
ATCCAAACATTCTCGAAAGAAACCTTTTTGACAAACCCAGAACCACCCTGCCAAGTCTTTATTCTAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415324] SGN-U271923 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267461 [Download] [View] Facility Assigned ID: STMDC68TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5