Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E415377

Search information 
Request: 415377Match: SGN-E415377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269797Clone name: STM-21-A8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269797 [STM-21-A8] Trace: SGN-T267515 EST: SGN-E415378 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415377Length: 555 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E415377 [] (trimmed) CGAGCTCCTTCAAACGCAGTAGAAGTTGAAAAATGACGCTTGGAGAAAGGCAAGGAGATGAGAAAAATGACTCCAAGTACTGCGGAGTAGAAACG
GAGTTCAACGATGACATGCCTCAACTTCTATCCCTCAACATTCATGGCGGATTCGACTTTGTTGTCGCACCATTGATGGATCCTGCTTACAGGCC
TAGTTTACTGGTGAGTAGCAATGGTGGATCTGGGGTGCTTCCATTCGCTGGGTCAGACTTGGTGCTAAGCCCTTCCCAATGGAGTAGCCATGTTG
TTGGTAAAATTAGCTCATGGCTTGACTTGGATTCTGAAGATGAGATGCTTCGGAGGGATTCTGAGATTACATTGAAACAAGAAATAGCCTGGGCT
TCTCACCTTTCACTGCAGGCCTGTCTTCTTCCTGCACCCAAGGGAGTGACCTGTGCTAATTATGCTAGATGTGTGAATCAAATTCTACAGAATCT
AAGCAATATGCAGTTGTGGCTAAGGATTCCATTGGAGAAATCTGATGATGATGATGGAAATAGAAGTCCTAACTCTATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415377] SGN-U272859 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267514 [Download] [View] Facility Assigned ID: STMDD04TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5