Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E415455

Search information 
Request: 415455Match: SGN-E415455
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269965Clone name: STM-21-I8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269965 [STM-21-I8] Trace: SGN-T267593 EST: SGN-E415456 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415455Length: 451 bp (924 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E415455 [] (trimmed) CTAAAATGGAGAACCCATCTTCATCGGAGAATTTGCTTCAAACCCTAAATACCAGAGGATGGTGTTTCCGGGATATCAATCTTGTAAACTCACTC
ATTGCAGCTCAATTGCCGTCATCATACACCGTTAGCTCAATCGAATCGGAGCTCCTAAACATAGACTTACGATCCGTCGGCGGGAAATCGTTGCC
GGACTCTTCTCTTCTCCGTAAATCGTCTCATATCCAAGGCCCTAAAGTCCTTCAAATATCTTCTGTCAGAGATATATCACGAAGTAATATGGCTG
AGAGTTCTGGAAGTTCCAGCAATCGGCGTCTACTTAGATTAAAGCTCACTGATGGGCACTGTGAAATAACTGCTATAGAGTACTCTCATATACCA
TCAATTCCTGATGATGTTGTTCCTGGCACTAACGTGCGCTTGGAGACAAAGCCACAGTTCACAGTGGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415455] SGN-U277987 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267592 [Download] [View] Facility Assigned ID: STMDD52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5