Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E416008

Search information 
Request: 416008Match: SGN-E416008
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270246Clone name: STM-22-G14
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270246 [STM-22-G14] Trace: SGN-T268146 EST: SGN-E416009 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416008Length: 707 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E416008 [] (trimmed) TCACACTCAAGACCTTCTACACACTCTCTACTGAAAACCCTAATTCATTTCTCCATGAAGAACAGATCATAATTTGATTGATTTCACTGAGAAGA
GAGAATATCCGAAGGTTTCGTTTCAGAAATTGAAGCAAAAAAAAGGAAAAAAATCAGCGTTAATGGAGGTTACTGTGAAGGAAAACGAATTTGTG
GTTTTATCGATTTCGGAGGTTTCATCTTCTTCATCTACTTCGTTTTCTAAATCGGAACCGGTTTTTGCTCGGTTTGGTTCGGGTTCTGGAGCTCC
GGAGCTCCGATTTGGACAGGAGTCTCAATCCGGTGCCGACATTGTGATCGTTCTTCGAGCTTCGCAGTTATTCAGGCTAGGATCTGCAGAATCTC
TGTGCATATCTGAAGTTTTTGAAGACAATAAGGAGACAGGCTATTCCAGAGGAATCTCCATTCAATTTAAAAACGAGGAGGAAAGTAGGGCCTTC
CATTGTGCATTTGAGCAATGGAAGACAGAAATGGTTGTTCAAGGGTCTCCTCTGCCAAATGGAGCAGTATCAACTTCAACAAGTAAATTCGATGA
AAAAATAGAGGCATCTTCTGCTAAAATGTATTTTCACTACTATGGANCACTATTGCATCAACAAAATATGCTGCAGGATTTTGTAAGGACAGGAA
CCTATTATGCTGCTGTAATTGAGAACCGTGCTGATTTTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416008] SGN-U271859 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268145 [Download] [View] Facility Assigned ID: STMDH43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5