Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E416022

Search information 
Request: 416022Match: SGN-E416022
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270286Clone name: STM-22-I10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270286 [STM-22-I10] Trace: SGN-T268160 EST: SGN-E416023 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416022Length: 506 bp (950 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E416022 [] (trimmed) GCCATTTTTATCAAGGACTTGTAGTTTAGAAGCTGCATAAAGTTGGGCAGAAGAGCTAGGAAGAGTAAGCATGTCAAGTGACAGTTGCAGCCACT
GGTGTTATAGTTGTAGACAACCAGTGAATCTCAGGAGACAAAATGATGTTTGCCCCAATTGCGGTGGTGGATTTGTTCAAGTGCTTGAAGACATA
ACGAGTAGTAGTGTAGATAATCAGAGCCAGAGGCCGAGATTTATGGAATCCGTCTCAAACTTTTTAAGACGACAAATCTCAGCTACAAGTAATAC
TTCTGAGAGAGGGAGATCTGATGGGGGTGCTGAACGAGGAAATTTATGGAATCCATTGCTGATTTTCAGTGGTGATACGCCTGTTCAGATGCCTG
GGGATGGTGGAGTTTTGGAGTTTCTTAATGAGGCTCTTGGCTTCCGACAAGAAAATGGTGGTGATTATTTTGTTGGTCCANGAGTGGAGGAATTT
TTTGAAGAAATTGTAAATAGAAATCAGCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416022] SGN-U273685 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268159 [Download] [View] Facility Assigned ID: STMDH53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5