Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E416023

Search information 
Request: 416023Match: SGN-E416023
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270286Clone name: STM-22-I10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270286 [STM-22-I10] Trace: SGN-T268159 EST: SGN-E416022 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416023Length: 514 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E416023 [] (trimmed) TCGCACTTTGGAAACCAAATACAATTCAGTCATCAGAAACACATGACAAGCTTCAAATGTACATTACAAGCAAGTAAACACATGGGGAGGGGGGG
GTTCTCTACCATGAGAAATCGTCTAAGTTCAACCAGAGGTAGAACATTATGATCATGAAGAATTTGAAAAAAGAAAACAGGTTACATTTAGAGAA
ACCTTGTTATTCAAAGGGCCAGTTGGAGTACTCAGAGTAATTATTGTGTTGATGGCTGGTTTGTGAGCTGGTTTCAGCAGCTGGAGTACTTCGGG
AACTAGAACGAGATGAACCAAAGTTCCAGAGGGAAGACCATGGTCTCCGCCTTTCTTGGTTCTGAGAACTGTTCTCCCTAGCACTAACTCGCCTA
CTGCTGCTTCTGCTTTCACTCCTTGAGTTTCGAGAAGAATGGTCATTGCCAGATTTTTCAGGTATCAGCTCCTTTCTACAGACAGGACATGAATT
CTTCTGTTCTAGCCATGGAGTGATACAATCTGAGTGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416023] SGN-U273685 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268160 [Download] [View] Facility Assigned ID: STMDH53TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0022 Quality Trim Threshold: 20.5