Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E416174

Search information 
Request: 416174Match: SGN-E416174
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270348Clone name: STM-22-L1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270348 [STM-22-L1] Trace: SGN-T268310 EST: SGN-E416173 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416174Length: 439 bp (934 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E416174 [] (trimmed) CAAACCTTTTTTTTTTTTTTTTTTTTGAGGATATAACTTGGATCTCAAATTTAGGCAAACACCAACAACAAAAATCCTGAGCCACCATGGAAAAC
AAACCATGGCACTTCAACAAAAGCAAAAGAAAACAGACTCAAAATCATGCTCGCCACCGCCTATCAAGTACCCAGTTCTGAGAATGAGTACTTGA
CATACAAGGCAGAGAACTAGAACCTAATAAGCAAATCAAAGACCAAACTAAAGCAGAACTAAATAAAACAGAGTCTAGATAGCACACTCGATGAA
AATAAATAGTATTGGAAACACCAGCATCACACTGCACTGGTCACTTTCCCTTCTTCTGGGCAGCCTTGGTCACTTTGGCACCAGTTGGGTCCTTC
TTGTCAACATTCTTGACAACACCGACAGCAACAGTTTGCCTCATGTCTCTCACAGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416174] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268311 [Download] [View] Facility Assigned ID: STMDI61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5