EST details — SGN-E416205

Search information 
Request: 416205Match: SGN-E416205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270393Clone name: STM-22-N13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270393 [STM-22-N13] Trace: SGN-T268341 EST: SGN-E416204 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416205Length: 292 bp (851 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E416205 [] (trimmed) TCTTTTTTTTACTACTAACTAAAATTCACTTTTTCACATCGTGCAAAANATATCATTCTGATTTACTCAATACAACATCAGTTCAATAAATAATG
CAAGAGAGAAATGTTCTTCTCATGCAGAAAACAAAAGACTTTAGAGATAAATGAATAGGGAAAATACATTTTGTATAACTTCACAACTCAATCAT
ACAATGCTCCTTTCGTGCTGCACATAATGAAAAATGCCCGACATTTTCCCCAGAAACCAGTCAACTCAAGAACCATTCACAATTAAATGTCTTTG
GCACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416205] SGN-U275046 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268342 [Download] [View] Facility Assigned ID: STMDI79TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0193 Quality Trim Threshold: 14.5