EST details — SGN-E416400

Search information 
Request: 416400Match: SGN-E416400
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270515Clone name: STM-23-C7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416400Length: 347 bp (938 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E416400 [] (trimmed) TTTTTTTTAAAGCTATAAAATATAACTTACGCAACACCAAAAGCAAATATCCTGAGGCACCTGGAAAACCAAGGCACCTCAACAGAATGAAAACA
GACTCCAAATCATGCTCGCCACCGCCTGTCAAGTACCCAGTTCTGAGAATGGTTACATGACATACAAGGCAGAAAACAAGAGCCTAAAAAGCAAA
TCAAAGACACTATAGCAGAAGTAAACAAAACAGAGTCTTGATAGCACACTTGATGAAAATAAATAGCATTGGAAACACTAGCATCACACTGCACT
GTTCACTTTCCCTTCTTCTGGGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416400] SGN-U277723 Solanum tuberosum Build 4 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268537 [Download] [View] Facility Assigned ID: STMDK16TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5