Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E416511

Search information 
Request: 416511Match: SGN-E416511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270657Clone name: STM-23-K17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270657 [STM-23-K17] Trace: SGN-T268647 EST: SGN-E416510 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416511Length: 200 bp (1007 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E416511 [] (trimmed) TTTGCGCAGCCACTGTGATTAGCGAGCTCCNTCTTTTCTTATCTTCAAAGATTCTAAAGCATCATGGGTAAGGAAAAGATTCACATCAGTATTTG
TGGTCATTGGCCACGTCGACTCTGGAAAGTCGACTACCACGGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTT
GAGAAGGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416511] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268648 [Download] [View] Facility Assigned ID: STMDK69TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0200 Quality Trim Threshold: 20.5