EST details — SGN-E416529

Search information 
Request: 416529Match: SGN-E416529
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270703Clone name: STM-23-M9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270703 [STM-23-M9] Trace: SGN-T268667 EST: SGN-E416530 Direction: Unknown Facility: TIGR
Clone: SGN-C270703 [STM-23-M9] Trace: SGN-T268668 EST: SGN-E416531 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416529Length: 530 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E416529 [] (trimmed) GTTTTTTTTTTTTTTTTTTGAAATAAATAGGAAAAATTTATAGCTCCATCAATAGGTCGATCAAAATGATACAAGATGTTTCCATACACAGGAAT
GAATAGATGAATGACAACAAATCTTACAAGAACAGGACAGCTTTTCCTTTATCTAATACCCCAATAACTATTTGAAGCTCTAGTGACATAATACA
CCCAGCCTATGACACAAATTTCTTAATAAATATGCTGTCACAAAATAGAATACATGATTGATTACAGAAGGGACGTAAAATTACGTGTATGAGTG
ATGGACTGTAGATTTTTACTCGGGAGAATCGTAACAAGATATTGAAAGACCTGCCAACAAGTAGCGAACAATCAATTTGCTGTTGTTTTAGACAT
GGCCTGCTTGACAGCCTCGGCGTAGGTCCTGTGTTGGTATGTGAGTGTGGATTCAAGCAAGTCCCTAAGGGAAGTCTTTGGGTTCCAACCAAGCT
GCCTGTTGATTATGGTCATGTCCGGAATCCTCTTGTCACTGTCATCATACCCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416529] SGN-U269030 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268666 [Download] [View] Facility Assigned ID: STMDK77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5