EST details — SGN-E416555

Search information 
Request: 416555Match: SGN-E416555
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270743Clone name: STM-23-O9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270743 [STM-23-O9] Trace: SGN-T268691 EST: SGN-E416554 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416555Length: 695 bp (973 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E416555 [] (trimmed) TGCATAAACACCTTCACAAAGATAACCTCTCTTTTCTTTTGCTTTCTGTGAAGCAAAATCAGCAATGGCGAAGGTTGTTTCATTTTTTCCTTTTG
GCCCTTATTGCCATTTCCATTGGTTGCAACCACTGCTCTAGCTGCTGATGCCCAGTACCACCTTGATCGTTCAAGGTATGGTCCAGGGAGCTTGA
AGCCAACACGTACGTTTTTTCTATCATATCTTTACATTTATTTAACTAAATAAAGAACTCAATTCTAGCCTAAGATTATTAAAATATTGAGATGA
TTAGTGTCAGGAATCTTTGTCTGGGTGGAATATTTACAATTTTGTTCTCAGAATAAAAAATTCAGCAACTCCTAAATACAGTTAACAAACACTTA
ACTACGGTTATTAATTAATCGATTAATAGCCTCCGATTGGGTGAATGTTCGAGTATTTAACATTTAAATATTCTGTGTAGTAGTAAGGAGAAGTG
GAGAACTGTGAATTTCTCATACCCGGTCCATCTTAGTTATCATGTTTTTTCTAATTTTCTCTTAATAAAAATTAATTTTAACTAAATTGTGGTTT
TACATTTTTATCTTAATTTAATACTCTATTATTTATCTATGATTCGAGGGACGTTAGTAGCGTATTTCTCAAATTATGATAATTTAGATTTGACC
TCTATATAAATATTTCATTACTTTTATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416555] SGN-U270671 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268692 [Download] [View] Facility Assigned ID: STMDK89THC
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5