EST details — SGN-E416679

Search information 
Request: 416679Match: SGN-E416679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270734Clone name: STM-23-O2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270734 [STM-23-O2] Trace: SGN-T268817 EST: SGN-E416680 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416679Length: 351 bp (975 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E416679 [] (trimmed) GCCGTCAACCCGCCGCTTGCAGCTCGTTTTTTACCCAACTTTCTTTGGGCCCCACCAAATTCGCTTCCGTTCCTCTCTTGGCTCCCTTTCACAAC
CCATCTTTTCCCAGAACCATCATCACTCGTCCAACGTTTTCCTCTTCCTCCATCATCACTGCTGCAATGGCTAGTGAGGCATCGGTAAAAGTGAT
TGATGGGAAAAAAGTTGCAAAAGATGTCAGAGATGAAATAAATGCCGAAATAACTAGGATGAAAGATTCGATTGGTGTTGTTCCTGGCCTGGCAG
TTATACTTGTTGGGGATAGGAAAGATTCTGCAACTTATGTTCGCAACAAGAAAAAAGCTTGTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416679] SGN-U271606 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268816 [Download] [View] Facility Assigned ID: STMDL85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5