EST details — SGN-E416749

Search information 
Request: 416749Match: SGN-E416749
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270566Clone name: STM-23-F23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270566 [STM-23-F23] Trace: SGN-T268887 EST: SGN-E416750 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416749Length: 671 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E416749 [] (trimmed) CCGTCACCACCGTCAACGCCGTTAATTCTCGCCGGCACTCCATTCTCTAAACTCCGTCAACCCTCAATTCTTCCTCTCCAAAATCCTCATAAATC
CTCTCTTCTCTCTCTACTCCATTGCATTTCATTCTCTTCAACATCTGATTTTTTCCGATCTCTCATCGAACTGTTGCGATGTCGGTGAAAACTGT
TAAAGTTAGCAATGTCTCCTTAGGGGCATCAGAGCGTGATATCAAGGAATTCTTTTCTTTCTCTGGTGATATTGAATATGTTGAGATGCAAAGTG
ATACTGAACGAAGTCAAATAGCATATGTTACGTTCAATGATTCTCAGGGAGCTGACACTGCAGTTCTTCTTTCGGGTGCAACAATAGTTGATATG
TCTGTTACGGTGACTTTGGATCCAGTTTACCAGCTTCCTCCTACTGCTTTTACAGCATCAGTGCCAACGGCAAAGAAAAGTGCTGGTAATTCAGA
ATCTGCTTTTCAGAAAGCAGAAGACGTTGTTAGCAGCATGCTCGCAAAAGGTTATATCTTAGGTAAAGATGCTGTGGGCAAAGCAAAGTCTTTTG
ATGAGAAACACCAGTTGACTTCAACTGCAACTGCTAAAGTGGCCTCTCTCGACAAAAAATTGGTCTCACTGAGAAGATAGCATTGGTACTTCCAT
TGTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416749] SGN-U272657 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268886 [Download] [View] Facility Assigned ID: STMDM36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5