EST details — SGN-E416756

Search information 
Request: 416756Match: SGN-E416756
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270611Clone name: STM-23-H7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416756Length: 502 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E416756 [] (trimmed) GTTTCAATCTTTAAACCAGTTCCCCAAAACCATTCTTGATAAACTCACTTCAGTTAAAAGAACTTGACCCAAATATCCCAGAACCAGTCCAAACA
TTCTGGAAGTGGCTATGTGATGAAGGGGTTGTATCAGCAAAGACACCTGTAAAGCCAGGAATTGTACCAGAAGGTTTAGGATTAGTTGCTAAGAG
AGATATAGCTAAAGGGGAGACAGTTCTAGAAGTTCCTAGAAGGTTCTGGATTAATCCAGATGCAGTTGCAGATACTGAAATTGGGAATGTGTGTA
CTGGATTGAAACCTTGGATTTCTGTTGCTCTTTTCTTGCTTAGAGAGAAATGGAGAGATGATTCAAAGTGGAAANTATTACATGGCTGTTCTTCC
AGAGTCTACTGATTCCACTATATATTGGTCTGAAGAGGAGCTTTCTGAGATTCAAGGGACTCAACTTTTAAGCACAACATTGAATGTGAAAGATT
ATGTACAAAATGAATTTCAAAAAGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416756] SGN-U271854 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268893 [Download] [View] Facility Assigned ID: STMDM40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0074 Quality Trim Threshold: 20.5