EST details — SGN-E416884

Search information 
Request: 416884Match: SGN-E416884
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270669Clone name: STM-23-L12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416884Length: 654 bp (895 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E416884 [] (trimmed) CACTTAATGGCCTCTTTTAGCAGAGTGATCCGCCGGACTTTCTCCACGGCTGAAGCCTCAGTATCTCCGATCAGAACAATCTCCGACGACTTATA
CAAAGAGAGGAACCTCAAAAGGCTCGTTGAGAAATTCAAAGAGTATTCAGATGTCACAAGATTCCGCACAAAAACCGGCATTTACGAATCTACAG
TTCATCGATTAGCCTCTGCAAAACGGTACAAATGGATCGAAGAAATCCTCGAACACCAAAAACAATACCGACCCGACATCTCCAAAGAGAGTTTC
GCGGCAAGGCTGGTGAGTTTGTATGGAAAATCTGGGTTATTTGAGAATGCCCAGAAAGTGTTTGATGAAATGCCTGAGAGAAATTGTAAGCAGAG
TGTGAAATCTGTTAATGCCCTTTTAGGGGCTTGTGTTAATTCGCAGAAATATGATAAACTTGAAGGTTTGTTTGAGGAATTGCTGGAGAAGTTGA
AGGTGAAGCCGGATGTTGTCACGTATAATATAATGATTAAGGGGTTGTGTGACANAGGGCAGTTGGATAAAGCAGCTGCCTTTGTTGATGAGATT
GAGAAGAATGGGTTAAAGCCTGATTTGGTTACGTTTAATACGATTCTTGGGGTGTTTTACTCGAATGGTAAGTTTGATGATGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416884] SGN-U278245 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269021 [Download] [View] Facility Assigned ID: STMDN66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5