EST details — SGN-E417067

Search information 
Request: 417067Match: SGN-E417067
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270842Clone name: STM-24-F13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417067Length: 583 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E417067 [] (trimmed) CGCCAATCTCGCACCCCCTACCGGCCTACCCCACCCCCACCACCATGCAATCACCATAGCTTTTTCATATGTACAAAGAACCAACAATATCTCTC
TCTTCCCTATTACACCATGACTCCTTTCCCTTTCTTCTTCATCATCGTCTTCTTTTGCCTCTTCCCTTTTCTCCCTTCTTCCTCTTCTCTTCACT
ATCCTTACAATTATTCTTTGCATATTGATTGTGGGAGTCTCTCAAATTCAACTGATATCTTCAATACTACATGGGTTTCCGACCGGTATTTTACC
GGCGGAGCAATTTCCGTTGTATCGGAACCTCTTCACTATCAGCACTCACAGGAGAAAACCCTTCGTTATTTCCCCATTTCATCTGGAAAGAAGAA
CTGTTATGTGATCCCCAATTTGTCTTCCGGCAGGTACCAGCTCCGGACGTTTACGGTGTATGATAATTACGACGGAAAGTCGCACTCGCCGTCGT
TTGATGTTTCCATTGAGGGTAATGTTGTCTTTCAATGGAGGTCACCTTGGCATGAAACTATCTCACGCGCCGGCGCGTATTCCGATCTGTTTTTT
ACAGTTTCTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417067] SGN-U280130 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269204 [Download] [View] Facility Assigned ID: STMDQ31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5