EST details — SGN-E417087

Search information 
Request: 417087Match: SGN-E417087
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270927Clone name: STM-24-J13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417087Length: 631 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E417087 [] (trimmed) ATCACCAAATCGCATCTCTCTCCCATCTCAGTTCCCATGCTCCCTCCCGTATCCAATCACTCCACCCTTCTTCATCCATGACCCTCCTCAAACCT
CTCCACCACCATCTCCGTCGCCGTCTCTCTATCTCCGCCGCCGCAGCCGTCCGTCAAGACACTAATCTCTGGACAACCGCACCTCTCGTCACCGT
TTCACCTGCCGCTGAATCTCTCTTCCACGTCACCATCGACGTGTCCGATTACCCTGACCTAGCTACCTCACACACCAAGGCAGGTCAGTATCTTC
AGCTTCGGATTCCTGACGTGGAGAAACCGTCGTTTTTAGCGATTGCATCGCCGCCTTCGCTTGCTGCAGCAAAAGGTTTATTTGAGTTCCTTGTG
AAAAGTATCTCTGGCTCTACGGCGGAGCTACTATGTGGATTGCAGAAAGGTGATGTTGTGGAGTTGAGTCAGGTTATGGGGAAAGGATTTGATTT
GGATCAAATCTCTCCTGCGGAAGAGTGTCAGACGGTCGTGATTTTCGCTACGGGATCTGGAATCAGCCCAATTAGATCCCTGATTGAGGCAGGGT
TTGGTGCAGACAAGAGATCTGATGTTCGGCTATATTATGGTGCACGGAATTTGAAGAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417087] SGN-U273085 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269224 [Download] [View] Facility Assigned ID: STMDQ55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5