EST details — SGN-E417573

Search information 
Request: 417573Match: SGN-E417573
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271322Clone name: STM-25-N15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271322 [STM-25-N15] Trace: SGN-T269711 EST: SGN-E417574 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417573Length: 587 bp (975 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E417573 [] (trimmed) CTAAAACCCATTTTCATCTACATCAATAACATCCAATTTTAACAATTTCTTTATCAATCTCAAAAGGGGAAAAAAATATTTTCTTCGATTTGAAA
AAAAAAAATGAGGGGATTAGAAGAAGAATTCATTCCATCAACACCAGGAAAGTTCAAAGACAAAACGTATTACTCCGGTAACCGGCAACTTCACC
GGTGTTTTGCTTCAACAAGTACAATGTTCTTATGGGCATTGTTTTTATTAGCTTTAACGGCGTCGTATTTGAGTTTTCAGTCCTTCATGGATTCC
GGTACCCGGTATCTCTCCTCCACATGGGGTAGTCTTCATTGGGAGAAACAAGTTCGTGATTCCGCCCAAATCCACCGTGTTAACGGCATGTCCGT
ACTCGTCACCGGCGCCGCCGGTTTCGTCGGATCTCACGTTTCAATCGCATTGAAAAAACGTGGAGACGGTGTCGTCGGAATTGACAATTTCAACA
ATTACTATGACCCTTCGTTGAAAAAAGCTCGGAAAAATCTGTTGAATTTGCAAAATGTGTACCTCATTGAAGGGGATATTAACGATGTTCATCTG
TTAGCAAAGCTATTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417573] SGN-U273643 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269710 [Download] [View] Facility Assigned ID: STMDU80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5