EST details — SGN-E417575

Search information 
Request: 417575Match: SGN-E417575
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271323Clone name: STM-25-N17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271323 [STM-25-N17] Trace: SGN-T269713 EST: SGN-E417576 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417575Length: 586 bp (976 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E417575 [] (trimmed) GTTTTGTTATTTTCTTTGTATCACCAAACTTTTCCCGAAGCCACTGATCGAATATTTTGGAACAGAAGATGTTCGACAAAATGACTGAACGGAAC
TGCAAATAGGCTTATCAATGGCGGTGCTTTCATCTCTTACAAGACGCACTGTTCTCTCATTCCCATTCACCAAACACCCATTATCCACAATTTCT
GCTTCTACTTCTTCTCTATCACAATCGGAAGATGAAACTTTAGTCTCAGCCGCCACAACAATCCTCAAACACCATCGCTCAAAATCACGATGGTC
CGAGATTCTTTCTCTAGCTCCTCCAACTTCCGGTTTCACTCCTTCCGAAGTCTCTAAAATCATTCTTCAACTCCGCAACACACCTCATCTCGCTC
TCCGTTTCTTCAATTTCACAGTCCACCGCTCCATATGCTGCCACTCTGTTTCTTCCTATGCCACCATCATTCACATCCTCTCCCGTTCTCGCCTC
AAATCCCAAGCCCTAGATTTAATCAAATGCGCTATTCGTAAATTTCCTGACACCCATAAACCTGATTCATCAAACCCACCTCGGATTTTCGAAAT
CTTGGTTAAAACTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417575] SGN-U282216 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269712 [Download] [View] Facility Assigned ID: STMDU81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5