Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E417619

Search information 
Request: 417619Match: SGN-E417619
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271107Clone name: STM-25-D16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271107 [STM-25-D16] Trace: SGN-T269755 EST: SGN-E417618 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417619Length: 545 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E417619 [] (trimmed) TCATAAAAAGGGAAACTATAATGAATAGATGCCCATCATTATCACATTCTCCCTCGTTGTACATTGTAACAGGGCACAAATGATGAAGGGTACAG
AGCTCTTGCCCAATCTATAAGTCCAATAACATGACTATAATATTTTACTACCAATATTCATCATTGCTATAGGAATAAAATAACATCAGCTGAAG
AAAATAGGGTAAGAAACCCAACAATATACAAAAAGAATTAATGATAATGGCAAGAACTTCACAAGCCTGCTGAGACCAGTCCATGTAAGGTAACA
ATACCAATCAACACATTATCTTGATCAATAACTGGCAAGAACTGGACTGGAGATGGTGGAGATTCCATTTTCTGCATTGCATCAGCTGCCATAGC
ATCTGGACCAATTGTCCTTGGTTTCCTGTTACACATTTCTCCAACTGTAAGCTTGAAGATTCCTTCCCCGCTGGCTTTCAATGTCCGACGTAAAT
CACCATCGGTGAATGTGCCGAGCAGATGAAACTCATCATCAATAACAAGAAGGCACCCGCATCCTTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417619] SGN-U273296 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269756 [Download] [View] Facility Assigned ID: STMDV20TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5