EST details — SGN-E417924

Search information 
Request: 417924Match: SGN-E417924
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271580Clone name: STM-26-K22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271580 [STM-26-K22] Trace: SGN-T270060 EST: SGN-E417923 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417924Length: 490 bp (933 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E417924 [] (trimmed) TTTGATCTGAATAATCCTGACCAAAACCAAAATTGTTTATCTAAGTAAATCAAAGGTAAACATGAGTAGGAGTTCAACTACACCATAGAAACTGG
CAATTGCATTTAAAGTGTTTGTTTTTAAGCTTCTGGCAAAAAAGATGAGCGAGCTGTGGTCTTAGTCGTTTCTCCTCCTATTGCTTGTGGGAGCG
GGGGGTTGCTCTGAGAGGATTTTCAAAACATTCACCAATGCCCGTAAACGATCCCAGATGTTCAAACCATAAAGAGTGTGCACCAGAGACTCTTG
GAACTCGAATCCATTCTCAGCAATAGGATACTGAATAGGCTTTGGTATCTTGGTTTTAATAAATGGCCACCACCGGTCCTCCACAACTGACTTTA
CGAGACAGCAAGCTCGTAATCCTTCAATACCAGCAAATCTTCCAAATCCACTGTCTTTGACTCCACCAAATGGCAAGGACTGACACATGTAATTT
GATGCGAAGTCATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417924] SGN-U272066 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270061 [Download] [View] Facility Assigned ID: STMDX71TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0033 Quality Trim Threshold: 20.5