EST details — SGN-E418193

Search information 
Request: 418193Match: SGN-E418193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271770Clone name: STM-27-E7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271770 [STM-27-E7] Trace: SGN-T270331 EST: SGN-E418194 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418193Length: 556 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E418193 [] (trimmed) CCCCTAATCGACTTCATCACATATAGAACTCTCTAGCAGCTCTACAAATCAGAATTCTTTAGGAAATACAGTGCTAAAGCTCTCAGATTTCGTCT
ACACTTTCTCAAAATAGAGAAAGAAGAGGTTGTAGGTCATCAAGTTCTACCCTATTTCGTGAGTTGATTTCCATCTAATCGATTCTTAGCATGTT
GATGTTTTTGGATAACACTTGAAGAAAGTTAGACTCCATTTGAGTAGGCGGAAGAAGATGACAAAGCACAACTATCATGTAAAGCAGACCACACG
AGAATCTTAACAGATTGAAATGACAGTGAAAATCTAGCAATTCAAAAGATACCTTGTGTTTTTCAGTCTTCACAAGGGAATGTGGCAGGTCATCT
CTAGCCACTTTTACATTGATGTTTGATTTTTTAAGTGTATGTACGTAGTTACACTTGATGAATTTGGACTTTTTTTCAGATTTTGAAGACTCAAT
TTATCATTTAAGATGAAGATTCAAAAACATCATACAACCTAACAAGGCGATTATCATTTGGCTCTTGNTGATGAATATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418193] SGN-U278834 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270330 [Download] [View] Facility Assigned ID: STMEA28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5