Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E418346

Search information 
Request: 418346Match: SGN-E418346
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271810Clone name: STM-27-G6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418346Length: 448 bp (999 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E418346 [] (trimmed) GTCAAAACTTGGAGACGGAAGTGACAACAGAACTAAGGTTCCAACAATATACAAGTTCATATTTGCATTTGGGCTCTTATTCTGCTCCCTCATTT
TTGTTGTCTTAGCAATAATCAAGACAAGAAAGGGGAGTAAGAATTCAAATTTGTGGAAGCTGACAGCATTTCAGAAGCTTGAATTCGGAAGTGAA
GACGTCTTGCAGTGCTTGAAAGACAACAACGTCATAGGGAGAGGTGGAGCAGGGATAGTGTATAAAGGAACTATGCCAAATGGTGATCATGTCGC
GGTGAAGAAGTTGGGAATAAGCAAAGGCTCACATGATAACGGCCTATCTGCTGAACTTAAAACATTAGGAAAGATCAGGCATAGGTACATTGTGA
GACTGCTCGCGTTTTGTTCAAACAAGGAAATCAACTTGCTAGTTTATGAGTACATGCTAAATGGAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418346] SGN-U282933 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270483 [Download] [View] Facility Assigned ID: STMEB39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5