EST details — SGN-E418405

Search information 
Request: 418405Match: SGN-E418405
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271919Clone name: STM-27-M16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418405Length: 675 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E418405 [] (trimmed) ATCAAGCAGAAGTATACTGCACAATGAGAGGCGCCGGACGACGTCGTACCAACTCTGTAGTACCGGATCGCCGCCATCCACCTCCGACTCCGATC
AACGACCCAAGACAATTTATCTCCACCGGCGGCCGTGATTCCGACGCAAGCTTCGCCAGTAGCCGGCCTTCATCTGCCGGTGTAAACACACGGTC
CTCCGCTATCCCCATCTCCGACCGCTCCTATCAACTCTCTGCTCTGCGTACAATCAATGCTTACCTTTCCTCCCACTCTCTCCCTTTTACTCTCA
AACATCCTCTCCCTTCTGCAAAAGATATCACCGAAACCCTAAAATTCATTCTCTCTCGTTTCGGATTTTCATCAGCAGAGTCGCACAAACTCGAA
GATAATCTCCAAACCCTACTGAAATCCCTAAATTGCCCCGTGAAATTGAACAAGTCTGCATTACGCGCCCCTGGGACGCCTCATTCTTGGCCTAG
TCTACTTGCAGCAATTCACTGGCTTGTTCAGCTGTGTAAATTTGATGATCACCGGTTGAGTTCGGCTCAACCACTAGCTCCGGATAACAAGGAAT
TGAGCTATACTATAGAAAGTTATTTGCATTATTTTAGGGGGAAAGATGAACAAGTAGATGAATTGGATCGTCAATTTATGCAAGAGTTGGAACAA
CATAAGGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418405] SGN-U279696 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270542 [Download] [View] Facility Assigned ID: STMEB80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5