EST details — SGN-E418462

Search information 
Request: 418462Match: SGN-E418462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271818Clone name: STM-27-H15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271818 [STM-27-H15] Trace: SGN-T270600 EST: SGN-E418463 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418462Length: 503 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E418462 [] (trimmed) CAGAAATGTACCCACCACCCAACAAGGTAAAAACCAGAGCCAAAGCCAAAGCCAAAGCCAAAATCCCCAACAATCAGTAGCAGCAGCAGCAGCGT
GTGCTCTCCACTCTCAACTCTCAATTCTCAATTCTCAATTCTCAACTCCCATGGCTACAAGCAGCAGCTGCAGTTCCCCTTATACCAACGGATCA
TCTCCAATAACGACAATAGCTCAAGACCATCTCTTCTCCATCTTACTCCTCTTACCTTTGGACTCCATTTTTTGCTTTGCTCTAACTTGTAAGAA
GTTCAGGTCCCTCACTTACTCAGACTCTTTATGGGAATCACTCTGCCGAAGAGATTGGGGAAACTCCACCATTGATGCACTCAGATCCTTTGCTG
TTGACGGTAAACAACAACAATTTCCTTGGAAGAAGCTCTACCAGCAAATCTACCAATTGGACTCTGTTTACTGTCGCAGACTGTTGACGCATCCA
CAAGGAGGAGAAGAGCTGCTTCTTCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418462] SGN-U278299 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270599 [Download] [View] Facility Assigned ID: STMEC44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5