EST details — SGN-E418622

Search information 
Request: 418622Match: SGN-E418622
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271941Clone name: STM-27-N16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271941 [STM-27-N16] Trace: SGN-T270760 EST: SGN-E418623 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418622Length: 567 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E418622 [] (trimmed) GGCAACACCGCGAATTGCGAAAACCCGGCACTCGACGGCGCAGCGGAGAAGAGAGCATTCTCTTCAGCTGCTACTACTCATATGCTCTTCAATCG
GAGAAGTTAGTAGTAGTAGATTTCGGTTACGGAGCTCGCCGGTGATTTTGAGAAAGAGAAAGCAACACTAAGTTCGAAGATGTCAGACCTAGATA
GGCAAATTGAGCAGCTCAAGAGATGCGAGCCGTTAAAGGAATCTGAAGTTAAGGCTCTTTGTCTGAAAGCTATGGAAATCCTTGTTGAAGAAAGC
AATGTGCAGAGAGTCGACGCGCCTGTCACTATATGTGGTGATATCCATGGGCAATTTTATGACATGAAAGAGCTATTCAAAGTGGGAGGTGATTG
CCCAAAGACAAATTACTTGTTTCTCGGGGATTTTGTTGATAGAGGATTTTACTCCGTTGAGACATTTCTTCTTCTACTAGCTCTTAAGGTGAGAT
ATCCCGATCGGATCACTCTTATCAGAGGTAACCATGAGAGCCGNCAGATCACACAGGTATATGGATTCTATGATGAGTGCCTACGGAAGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418622] SGN-U271408 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T270759 [Download] [View] Facility Assigned ID: STMED80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5