Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E418895

Search information 
Request: 418895Match: SGN-E418895
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272084Clone name: STM-28-F15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E418895Length: 571 bp (1012 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E418895 [] (trimmed) CGACATTGAAGAGAAAATTAAGGAAAACATCAATATGGCAAGTTTTGATATTCCAACAATTGATGTTTCTCCATTTTTTAAATCAGAGGAAAATG
AAGAAGGGAAAAAGAAGGCTATGGAGCAAATTAAAGAAGCTTGCGTTAACTATGGTTTCTTTCAGATTGTGAATCACGGAATTCCTTCAGACTTG
TTGAGTAGAACCATCGATATGTATAAGACTTTCTTTGCCTGTTCGGATGAAGAAAAACTGTCGGTACCTGATAATTATTTAAAAAGCACACCGAA
TTCAGCTGATACTTTTGAGCACTTGTGGTTTCGTTTTCCGTTCTCTGGCTTCAATAACTGCCGCAGCATTACACCTTATTTCAAGCAAGTATTGG
AGGAGATGGTTTCCCATTTCACAAAAGTAGGAGTTGTGTTGGAAGGAATCATAAGTGAGTGTCTTGGACTCCCTCCTGACTTCCTATCAAACTAC
AGAAATGATCGTTCTCGGGACTCATTGATGGGCCTNCACTACTTTCCAGCGACAGAAGATGACAACACAGGAAAACCTGCACATGAAGATCCTGG
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E418895] SGN-U271224 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271032 [Download] [View] Facility Assigned ID: STMEG32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5