EST details — SGN-E419136

Search information 
Request: 419136Match: SGN-E419136
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272372Clone name: STM-29-E7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419136Length: 367 bp (994 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E419136 [] (trimmed) CCTCGAGTTTTTTTTTTTTTTTTTTCATAGAAATTATTTTTTTCACAATCAGGTTAATACTTTGTTCACTTTCACAAACTGACACCGACTTCCAA
GTTAAAAGACCATTATTTTTACAAATGAAACCACAAATAAATGCTTTGAATTTTATTGATACAACTGCAGCGATATGTTTGCCAAGATGAGTGAC
CATACAACACCAAATCTTTTATGTAAACTTCAAAACTAATTGATTAAAATTTGTTCATTTTGCTTGGTAGTGAAGTTGAGGCTTCCGTTAAACCG
TGGTCATCAAACCCCATTCTTAACATTCCTCATATATTTGGTAGAAGAGTTGAAGGATCAGAAGGAACATCAGCACTTGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419136] SGN-U270415 Solanum tuberosum Build 4 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271273 [Download] [View] Facility Assigned ID: STMEI28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0022 Quality Trim Threshold: 20.5