Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E419444

Search information 
Request: 419444Match: SGN-E419444
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272463Clone name: STM-29-J23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272463 [STM-29-J23] Trace: SGN-T271582 EST: SGN-E419445 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419444Length: 597 bp (1027 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E419444 [] (trimmed) CCAAAGCAGCAGCAAGCAACTGAGAAAAGAGGCAGCAAATAGCAATTGAAAGCTGCTCTGTTTCATCTCTGTGCTTCTGCAAATCCGGCCATTTC
TGTGTATCCATATCTATACATACATATATATTATATATATAGAGAGAGAGAAGGTGAAAAGGATGATGTGGGTTCGATCGATTCGGCGGCCATTA
TCGTCGTTGGTTCTACTTCAGTCGCGTGCCCCGAATTATTCCTCATTGTCAGCTTCAGCAGCTGCAGTAGAAGCGGAACGATGTATAAAGGAAGG
ACCCAGAAATAACTGGACTAGAGAAGAAATCAAGTCTGTTTACGATTCACCACTCCTCGATCTCCTCTTTCATGGCGCTCAAGTACATAGACATT
CTCATAACTTTAGAGAAGTACAGCAGTGTACTTTGCTGTCTATTAAGACAGGGGGATGCAGTGAAGATTGTTCGTATTGTCCTCAATCATCTAGA
TACAACACAGGACTGAAAGCACAGAAACTTATGAATAAGGATGCCGTCTTGGAAGCAGCAAGAAAGGCAAAAGAGGGAGGTAGCACTCGTTTTTG
TATGGGTGCTGCATGGAGGGATACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419444] SGN-U277056 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271581 [Download] [View] Facility Assigned ID: STMEK60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5