EST details — SGN-E419515

Search information 
Request: 419515Match: SGN-E419515
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272308Clone name: STM-29-B18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419515Length: 613 bp (1000 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E419515 [] (trimmed) CCATTTCACATGAGAGAGTAGAGGAATGACGAGAACTTCCTTTACTTTATCTTCCTCTTCTTCGCTTATCCCCTCTCCGACTTCTATTGGTGGTC
GCCGTCGTATCATCGCCGGCGCCGGCGTCGGCCTCCTTTGTTGCGCTGTGGCCGCCACAACCTCTTCTTCTAGGATTGCATTTGAGAAGAAGAAA
CAGTGGAAAGAAGGTGAATACCCAGGTTTCTCTGAAGTTTCCGTTTCCCACCTGAACAACAAGAAGGGGAGGGGGACCCCTATTAACAAAAAAGT
CCATAGAAAGAATACCACCAATCCTTGGGTCAATACTGTTCCTGAAGCTCTTTCTGATTGCATTGATAAAAAGCAATGGCAACAAGCCCTTCAGG
TATTTGAGATGTTAAAGAAGCAACCTTTTTATCAACCAAAAGAAGGTACTTACATGAGGCTCCTTGTTCTTCTTGGAAGATGTGGGCAACCAGGA
CAGGCTCAACAGCTTTTTGATTCAATGATTGAAGAGGGACTCGAACCTACTTCCGAACTTTATACGGCCTTGATTGGTGCTTATTGTAGAAGCAA
CATACTTGACAAGGCATTTGCTCTTCTTCATGCCATGATTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419515] SGN-U278674 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271652 [Download] [View] Facility Assigned ID: STMEL09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5