EST details — SGN-E419628

Search information 
Request: 419628Match: SGN-E419628
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272590Clone name: STM-29-P4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419628Length: 479 bp (1026 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E419628 [] (trimmed) CACACTTTCACAAAATACTGAAAGTGAAGTGATCAAGTGTAGAGAGAGCCATGGCAATTCCTAATATACGGATCCCTTGTCGGCAGTTGTTCATC
GACGGTGAATGGAGAGAACCCCTCAAGAAGAACCGGTTACCCATCATCAATCCGGCCAACGAAGAAATTATCGGGTATATTCCGGCAGCTACAGA
GGAGGATGTAGATATTGCCGTCAAAGCTGCACGGAGTGCGCTTCGTCGGGATGACTGGGGTTCTACTACTGGAGCACAGCGTGCCAAGTATCTTC
GTGCTATTGCTGCTAAGGTACTGGAGAAAAAGCCTGAACTAGCTACACTTGAGACGATTGATAATGGAAAACCCTGGTTCGAGGCTGCCTCGGAT
ATAGATGATGTCGTAGCGTGTTTTGAGTACTATGCAGATCTCGCTGAAGCTTTGGATTTCAAAAAGAAGACTGAAGTTAAACTTTATTTGGATTC
ATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419628] SGN-U268974 Solanum tuberosum Build 4 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271765 [Download] [View] Facility Assigned ID: STMEL86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5