EST details — SGN-E419641

Search information 
Request: 419641Match: SGN-E419641
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272581Clone name: STM-29-P18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272581 [STM-29-P18] Trace: SGN-T271777 EST: SGN-E419640 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419641Length: 775 bp (873 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E419641 [] (trimmed) TCTTTTTTTTTTTTAAACACTTCTTTATAAACTATAGCTGAAAAAAAAACTAGGTCTTCATGTTCTGGCTTTAATCAGCTCTAATTGCCAAATCA
CTGTCCAGTTGCTTTGATAAAAGCAAATGCGACTACTATCAAACATGTTGCATATAATGTAATGTACAGTAAACTATTCATATCGACTGTAAGAA
ATCGGAGAAAATGAAATGAGAACGAGCATCATCTCCTCTAAATCTCCATCGCAATTCCCATTCTAACTGGCAGGGGTTACTCCAGATGCTTGCCT
TTTCATGTTAGCAATGTGCTTTTTACCAGTGACATGATGACTGAAAACAGTCTCACTGTTGCAAACCACCTTGCATACAAGACACTGACGGACGT
CGTTTGCAGCTGCTCCTCCTTCCAAAACCTTTTGTGTCTTGGTCTCCAATTTCTCACTCAGCTCAGCTGCCTTCTTCATTGGATCTTGCCCATCT
CCAGAATTTACTATGCCAGGCTTCTCTTGTGGTCCAATAAATGTGCTAACTGACACCTCCAAAGGAACAAGAGATGCAGAAGCAGGGACAGACTT
CTGTTGCTTTGTTATGTTAGCAATGTGCTTTTTGCCAATTAGATGAGTTCTGAAAACAGACTCACTGTTGCAAACCACATTGCAAGGAAGACAAA
TACGGATGTTGTCTGTGGCTGCTCCTCCTTCCAAAACCTTACGTTTTTTTGTCTCCAAATTCTCAACAACTTTAACGGCCTTATTCACTGAATCT
CGTCCATTTGCTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419641] SGN-U277945 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271778 [Download] [View] Facility Assigned ID: STMEL93TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5