EST details — SGN-E419676

Search information 
Request: 419676Match: SGN-E419676
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272644Clone name: STM-30-C13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272644 [STM-30-C13] Trace: SGN-T271812 EST: SGN-E419675 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419676Length: 336 bp (897 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E419676 [] (trimmed) AACTTACAAATACTTAGTGCTTGTACATAACAAGCATTATTCAGTAGACAGATTATATTAGTCCAGAAACAGGGAAATTGAATGTTATATAGCAT
TGGAGAAGCCAAAAGATCCATAATGTTCAAGTAAAGTTTTCGATTAACATTTCAGCGCTTCTTATTGCCTGTTGCAACTTCCCAAGCTTGTAAGA
TATGGTTCACTATGTCCTCTACGCCAACCCCATGCTTCACCTGAGCAAAAACAAAAGGGCCACCATCCCGCATCCGAAGTGCATCACGCTCCATG
ACGGACAAATCTGCTCCCACAGCTGCTGCCAAGTCGGTCTTATTTATCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419676] SGN-U271426 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T271813 [Download] [View] Facility Assigned ID: STMEM19TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5