EST details — SGN-E419875

Search information 
Request: 419875Match: SGN-E419875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272794Clone name: STM-30-I8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C272794 [STM-30-I8] Trace: SGN-T272013 EST: SGN-E419876 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E419875Length: 581 bp (983 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E419875 [] (trimmed) CTTTTCAAAAATGTGAAACATGTGGTATCTCAGTGGCTATTGCGTTGGCTGACATGCATGAATGTGAACCCAGAAAGGATGTAAAGAAATTGAAA
TGCCAACCCAGGAGCAGAAACATTGTTAAGGAGAAGAGGCTTATTCACCAACCCAGATCGGCTTTTCGAATTTTCATGGAGGATTTTGTGAAGAA
AAACATCGACGGAAATGAGTTTGAAGTAGATAACAGAGGTTTTGAGACATGGAAAAACATGACACGTAAGGAGAAGATTTTGTACTTCATGAAAG
CCGAGACAATTAATCTTGCACATGTGAAACTTTTGCACAGAGAGGAGCATGATATGCCATGGAGGGTGGATGATGAGGCAGATTCAGCTGATGTT
GGCAAGTATGATGAGAATTATGAAGACTATGATTATTATGATTCTGAATCTTCTTGGGATTTGATTGATTTTGGCCTGAGGTAGACAAGAGCTTT
GACACCAGTGAGAGGGAGGGTTTGTTCCCGTGTAAAATCTTGAGGATTGAACATCATTTTGATTTTTGAGGTGGTTCCATGCTTTGGACTAATGG
AATCCTTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E419875] SGN-U276121 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T272012 [Download] [View] Facility Assigned ID: STMEN52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5