EST details — SGN-E420481

Search information 
Request: 420481Match: SGN-E420481
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273049Clone name: STM-31-E12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273049 [STM-31-E12] Trace: SGN-T272617 EST: SGN-E420480 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420481Length: 602 bp (958 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420481 [] (trimmed) ACAACTTTTTTTTTTTTAAAGAGAATCAAGACTTTTATTATAGATATCGTCACACATGTTTAAAGTACAGAACATTTACAAGCATATATATGTTT
GATGAAATTTTCTACTTTACAGTATTCTTATTCCACAACATATGTATAAGAGCAGTAATGTGATGCAGCACATATATAAAGATGTTGTTATATTT
GATTTGAAACCCTGTAGTAATTTGTCAAAGTCTTCCCATCCAACTCCTTTGAAAAGAATCTACCCATATAATCCGTGTACATGAATTCGCGGTAA
ACGGCTGGCTTCTCACCTGATATTAGTTCAGGGAGAGGTCCAAATGAGTTCTCTCTTTGGCCTGNGTTAAAGAAGATGGCAACTGATACGCGGGG
TTCTTGAAAAGGGTTGGCTAGAACTCGGTGCACCACACTCTTGTATTCATCATTCGATATTATCTGAAGAATATCACCAATATTAATCACAATAG
CCCCCCGGATCGGCTTNCAATCCACCCAATCTTCCCCAAATTTCACTTGCAATCCAGTCATTTCATTCTGCACCAACACCGTCAACACACCGGGA
TCCGTATGCGGTGTCAGCCCTTTCGTCAACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420481] SGN-U273708 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T272618 [Download] [View] Facility Assigned ID: STMER30TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5