EST details — SGN-E420900

Search information 
Request: 420900Match: SGN-E420900
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273257Clone name: STM-31-N16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273257 [STM-31-N16] Trace: SGN-T273036 EST: SGN-E420899 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420900Length: 705 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420900 [] (trimmed) TTTTTTTTTTTTTGGTCTAAATGTTCATCATCTACTTTATTTGACCATTCTCAACATTTTCCACTAATACATACTAGTAGTTTTCAAAAGCATAA
AACATCTTTTTTTGATATACATTTTTAGACATTTGGTAAAAACTTATTTTCTCAAATTTAAAAAGTTTATTTTTACAGATTAAACATGACTTTAA
TAGCATCACCACCACGAGCACTTGTTTCAAAAGCTTCTTCAACTTCTTTTTGAGAGAATCCAAACCTGTGTGTGATCAAAGGTTTCACATCAATC
TTTCCACTTCTTAAGAATTCAAGACACAATGGCCATGTATTCTTGTAGCGAAATATGCCGATGACGTCGACCTCCCTTGCAGCAGCTGGAGTGAG
AGGAACAGTCATCTCATGATGTCCCATTCCCACCAAGCAAACTTTGCCACCTGGACGAGTTGCACCAAGGGCGGTCGACATAGTTTTGTTAAAGC
CAGCACAGTCAAAACTCACATCGATTCCACCTCCCATTGCTTTCTGAATGTTTTCTATATCTGTAGCTACGTCCTGGATATTGATTGAAACCTTG
ACGATGTCATCTGCTCCTAACTTCTTTGCAACAGAAAGACGATAGTCATCTACATCCACAATAACAATTCTTGGGGCACCAAAAGCACGAGCAGC
AAGCAGTGTGACAAGCCCAATCGGTCCAGCTCCCAGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420900] SGN-U275174 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273037 [Download] [View] Facility Assigned ID: STMET80TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5