EST details — SGN-E421007

Search information 
Request: 421007Match: SGN-E421007
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273491Clone name: STM-32-I13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273491 [STM-32-I13] Trace: SGN-T273145 EST: SGN-E421008 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421007Length: 347 bp (1074 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E421007 [] (trimmed) TTATTACAATTCTCCACCCCCACCATCACCACCACCTACTCCAGTATATGAAGGGCCATTGCCACCAATAGTAGGAGTTCAATATGCTTCACCAC
CTCCACCACCCTTTTATTAATTCTTTCAGAAATTTCCACTAACTTATCCTCAAAGCACAAAATTATCCCTACAGTTATTATTTCCTCCAACTCTT
CAAGCCATCAACAAAATCGAGCTAATACGTGATCACAAAGTTAAAATGGCGTGACAGAAAGAAAGAAAAAAGAGGAGGAGGTAAAGAGGAGAAAG
ATTCAATCTCCGCAGATTTTATTTTTGAATTGTTCTCAAATAGATTGAAGTTGTGGAGCGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421007] SGN-U273346 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273144 [Download] [View] Facility Assigned ID: STMEU55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5