Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E421210

Search information 
Request: 421210Match: SGN-E421210
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273622Clone name: STM-32-O20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421210Length: 698 bp (950 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421210 [] (trimmed) GGATTTCTTGCCATTGCCAAAATTTCAGCCTCCTACTGCTTTGATGATGTATTGGATGATTTAGTAGTATCTCTTTGCAAGTTCACAACTCTTTT
GTGTCCATCATATACTGATGAATTTATTGTTACATTTGCCCAAGATAATAAAGCTAGATTGTCCACTTTAGCTGTCTTCACAATAGCAAACAAGT
ATGGGGACCATATTCGTTCTGGTTGGAAAAACATCCTGGACTGCATTTTGAGCTTGCATAACTTTGGCCTTCTTCCTACTCGTCATTTTAGTGAT
GACGTGGAGTCTACTTCTGATGCTGACAAAAGCAAACCTGCTGCAGCTTCCCCATCAGCACCTCATGTGCCTTCATTGGCTCCATCAAGGAAGTC
ATCTGGCTTAATGGGCCGATTTAGCCAACTGTTATATCTTGATGCAGAAGAACCTGCTCCTCAGCCAAATGAAAAGCAGCTTGCCGCCCGTCAGC
AGACTCTTCAGACTATTCAGAATTGTCACATTGATACCATCTTTGCTGAGAGTAAGTTTTTGCAAGCAGAATCCCTTTCACAGCTTGTCCGAGCC
CTTGTGATGGCTGCGGGCCGGCCTCAGAGGGCAACATTTCTCTAGAAGATGAAGAGACTGCAGTATTCTGTCTAGAGTTGCTGATTGCAATCACG
ATAAACAACCGGGATAGGATAATGCTTCTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421210] SGN-U277535 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273347 [Download] [View] Facility Assigned ID: STMEV94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5