EST details — SGN-E421276

Search information 
Request: 421276Match: SGN-E421276
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273479Clone name: STM-32-H23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273479 [STM-32-H23] Trace: SGN-T273412 EST: SGN-E421275 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421276Length: 822 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421276 [] (trimmed) CTACTTTTTTTCAGTTGAACTATGAGAAATTTATTTTTAAGCAAAAGCAGGCCTAAATGTCAAAGTGCAACAAATAATGCTAAGATCATTACGTT
CACAATTGGTCCACTTCAATAAAAAGATATATCTAGCAGTAAGGATTTTGCATGACAAGGCTACAAGGGTAAACATTGTTGTTGATTAGTGAGAT
TACAGTAGACATGTCATGGATGAGAGGTGAGCCAGCAAGCAAATAGCGGACGTTCTCTCAAGACGAGCAGCAGCCACTATTCTGAGCAACGGGCT
GTCCACGAATATTTACATTTGGAGGCTGGGCAGCATTTGGGGCCGGTTGGTTTGCCATACTTTTCTTGATAGCAGCAGTCATAGCCATGAAAGAC
TCTTCTACATTACTAGCATCTTTCGCACTGGTCTCCAAGAATGGAATACCAATTTCATCAGCAAAGGCCTTAGCCGTTTCATACGACACAACTCT
ACTAGCAACAAGGTCAGACTTGTTCCCAACAAGAATTTTGTTAACATTTGGGGTAGCATAACGGTCAATTTCACTCAGCCACTGCTTCACATTAT
TGAAGCTCTCCTGATCCGTCACATCATAAACAACCTACCATAGAGGCCATAAAAAGAATGTAGAATGTAACAGGTAAAGAAAGCAGTTGACATTT
AACTCTACAGGCAACTAATTATTATTTATATTGTGTTAAGAAAAGTAAGGTCACTACTCACTATTATGCCATGGGCTCCACGATAGTAGCTGCTA
GTGATAGTCCTANNAACGCTCTTGTCCAGCGGTATCCAAATCTGAAGCTTAATGGTCTTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421276] SGN-U270182 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273413 [Download] [View] Facility Assigned ID: STMEW48TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5