EST details — SGN-E421451

Search information 
Request: 421451Match: SGN-E421451
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273563Clone name: STM-32-L22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421451Length: 672 bp (960 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421451 [] (trimmed) GCGATACAGAGAAAAAAGACGGTGAATCGAAGGTGGCTAGTAGTGGAGGTGAGGTGGTTAACAAAATGGAATACTATGGTTATAATGCAAATACA
TTTTACGCAATGCCTATGCAACATCATGGTTATATGAATCAAGACTATGGCGCGACAACGTACGATTATGGCTATGGTCATACGGGCTACGTAGT
CGAGTATGGCCACCAGCCACAATATGTGCCGCCACCTCCTCCACCAACATACTTGAACGCGCCTCAAATGTTCAGTGATGAAAATCCTAATGGTT
GTTTCATTATGTGAACTAAAATGTTCGATTTTCATCAACCTTTCTGAAAGACACAAACTCTAATTAGGAGTCTTGTCTATGAAGTAGAGCGACCT
CGATTGTGACCTCATTTTTATTTGATTGGTTCAGCTAAATATAATTGTACAAAAATCTAAGATGTAAAAGCTGAAAAATAGATACCTATGAAAGC
TAGCTTATACATGAGGATAGACAATAGAGTGTCGTCTTAAGAAATTTTATAAGCTAATTAGTGGGAAAAGGGCTAAACCACCATATAGTGGTGGA
TTAATCAGTATTCATTTATTTGTTTATTTTGACTTGTATGTCATTTATTAATTGGTAGCTTAAAATGTATTCAATCTTTGGCAAATTTATATAAT
CTCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421451] SGN-U271828 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273588 [Download] [View] Facility Assigned ID: STMEX71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0095 Quality Trim Threshold: 12.5